Companion viewer for the BRANCH assembler

See the genomic changes other tools miss.

Shows the genetic changes that diagnostic panels routinely miss — duplications, deletions, rearrangements, and rare mosaic variants present in just a few percent of cells. Built for long-read sequencing data; each variant stays visible individually rather than collapsed into a single line of a results table.

VariantPaths — chr14:106 080 000-106 720 000 · example locus 106.10M 106.25M 106.40M 106.55M 106.70M gene Sample A 3 821 bubbles Sample B 5 244 bubbles Sample C 2 906 bubbles Selected · b_44912 · Sample B · chr14:106 312 408-106 318 944 Length 6 536 bp VAF 0.034 mosaic Reads 47 / 1 384 Class DUP-paralog Recurrence shared (3/3) dbVar nstd102 · 0.91 reciprocal alt-paths (3) P0 │ ATGCCGTAAGCTACCGTATGCAGGTT P1 │ ATGCCATAAGCTGCCGTATGCAGGTT P2 │ ATGCCGTAAGCTACCGTGTGCAGATT Right-click → MSA · Copy as FASTA · Open in dbVar 11 971 bubbles · VAF 0.02-1.00 · 12 lanes/sample · 4.2 ms/frame live

Your genome isn't a clean blueprint.

Some genes vary wildly in copy number — not in patients, in healthy people. And often within a single person. Standard sequencing routinely undercounts every region in this list.

AMY1
salivary amylase
low end ×2
high end ×15+
~7×range across healthy populations

Higher copies in starch-eating populations — recent human evolution caught in the act.

C4
complement
low end ×2
high end ×8
low copy = lupus risk factor

Part of the complement cascade. Reduced copy number is an established autoimmune-disease risk.

DEFB4
β-defensin
low end ×2
high end ×12
mucosal antimicrobial firepower

Antimicrobial peptides defending mucosal surfaces. Different people carry very different defensive arsenals.

KIR
NK-cell receptors
haplo A 6
haplo B 9
~25haplotype combinations in the wild

Killer-cell receptors come in entirely different gene combinations between people. Decisive in transplantation and viral defense.

LPA
lipoprotein(a)
low end ×10
high end ×50+
~5×repeat range sets cardiovascular risk

Plasma Lp(a) levels are determined by the number of internal kringle repeats — a direct cardiovascular-risk signal.

IGHG4
maternal duplications
typical ×2
carrier ×3-4
fewer antibodies for the babymaternal IGHG duplications reduce IgG transfer across the placenta

Common but previously unrecognized: IGHG locus duplications and triplications create hybrid IGHG1→IGHG4 fusion genes. Mothers carrying them transfer less IgG to the fetus — measurable as lower antibody levels in newborns and higher respiratory-infection risk in infancy. Reported in Belios et al., medRxiv 2025.

Are you confident standard short-read sequencing is seeing all of this? Tumor subclones, somatic mosaicism, immune-cell rearrangements — they all break the comfortable fiction of "one genome per person." VariantPaths is built for the regions where conventional tools quietly fail.

What does this actually do?

Four concepts, in case the field isn't your daily bread.

What are structural variants?

Not every genetic change is a single-letter typo. Sometimes whole stretches of DNA are duplicated, deleted, or rearranged. These structural variants drive many rare diseases, cancers, and developmental disorders — and conventional short-read sequencing (whether targeted panels or whole genomes) often misses them.

What is long-read sequencing?

Older methods chop DNA into tiny fragments and reassemble them after the fact. Long-read platforms (PacBio, Oxford Nanopore) read very long stretches in one piece. The payoff: complex rearrangements that used to be invisible become visible.

Why a new viewer?

Most tools collapse a complex region down to a single summary line in a results table. Important alternative versions vanish. VariantPaths keeps every variant as its own visible object, stacked on screen — so you can actually look at what is there.

Built for BRANCH

VariantPaths is the companion viewer for BRANCH — a long-read assembler designed specifically to find low-frequency copy-number variants. BRANCH does the discovery; VariantPaths shows what is there. Together they make rare structural variants visible end-to-end.

Every variant, fully visible

Standard genome viewers reduce complex regions to a single row in a table. VariantPaths reads the bubble graphs that BRANCH produces — keeping every variant, every alternative path, every supporting read as its own visible object on screen.

Compare samples side by side

Stacked rows per sample, like reads in IGV. See which variants are shared, which are unique, which appear in your control.

Zoom to base resolution

Below 5 bp per pixel the actual A/T/C/G letters appear inline. Inspect breakpoints, confirm exact insertion sequences, copy regions for primer design.

Resolve paralogs and alleles

Right-click → MSA. Aligns every alternative version at that locus side by side. Distinguishes a real variant from a paralog mismatch.

Catch variants in just a few percent of cells

Filter by frequency, length, recurrence. The 2–3 % mosaic range — tumor subclones, somatic mosaicism, early clonal events — is finally visible.

Know what is novel vs. known

Every variant is annotated against dbVar, NCBI's public structural-variant database. "Already documented" or "never reported" is visible at a glance — no separate spreadsheet.

Runs on your own machine

Single executable, no installer, no Python environment. Patient data never leaves the network — relevant for any setting with strict data-handling rules.

Build it yourself

VariantPaths is in active development alongside the BRANCH assembler. Pre-built binaries aren't published yet — clone the repository and build from source.

1 git clone https://github.com/schlein-lab/variantpaths.git
2 cd variantpaths && cargo build --release
3 ./target/release/variantpaths samples/igh_3sample.vpf samples/igh_3sample.vpz

Built for the variants that don't fit a single reference.

Long-read sequencing reveals duplications, deletions, complex rearrangements, mosaic variants, and paralogous regions where one linear reference is no longer enough. VariantPaths shows them as they actually are.